Mobilization Of Dendritic Cells Research Articles

Abstract PO2-03-11: A novel peripheral CD4+ T cell immune network associated with response to PD-1 inhibitor in early-stage triple negative breast cancer

Abstract A novel peripheral CD4+ T cell immune network associated with response to PD-1 inhibitor in early-stage triple negative breast cancer Background: Immunotherapy has showed benefits in early-stage triple-negative breast cancer (eTNBC). However, there is an urgent need to identify novel biomarkers that can guide stratification for immunotherapy in eTNBC. Anti-tumor immunity is a systemic response that encompasses the mobilization of dendritic cells, lymphocytes, and myeloid cells involving the tumor, blood, and lymph nodes. The activation of anti-tumor immune responses via immunotherapy is expected to reflect in the subset change of circulation. Combined with advantage of dynamic monitoring by liquid biopsy, we detected peripheral blood in the eTNBC patients under immunotherapy to explore potential immune therapeutic predictive subsets. Methods: Single-cell (sc) RNA sequencing was utilized to determine the transcriptomics of immune cells in the peripheral blood. Meanwhile scTCR sequencing was used to trace the dynamic changes of clonetypes under multi-therapy. Nanostring analysis of primary tumor and in vivo models were used to validate the mechanism of immune crosstalk. Prediction index was built based on the proportion of immune subsets at each time point and change of tumor size in each patient. Results: 12 eTNBC patients who participated in neoadjuvant chemotherapy in combination with PD-1 inhibitor (Toripalimab) clinical trial were included in this study. The clinical trial consists of two stages. All eligible patients received four cycles of EC (cyclophosphamide plus epirubicin) regimen and followed four cycles of nab-paclitaxel plus PD-1 inhibitor. Among the 12 patients, 5 patients achieved pCR, while the remaining 7 patients were non-pCR. Peripheral blood samples were collected at baseline, after chemotherapy induction, and on PD-1 inhibitor treatment for scRNA- and scTCR-sequencing. Through prediction index, a novel predictive pattern based on ratio of memory T cells (central memory T and resident memory T) to effective T cells in the peripheral was vividly defined, by which the patients could be classified into C-type (memory T cells dominated) and E-type (effective T cells dominated). The C-type indicated better efficacy of immunotherapy combination therapy, while the E-type suggested better efficacy of chemotherapy alone. Meanwhile, a novel peripheral CD4+Trm (resident-memory-like) subset that possessed both strong differentiation potential and memory function was higher in pCR group at baseline. TCR-tracing analysis revealed that the new clones induced by chemotherapy mainly belong to the CD4+ Trm and CD8+ CD161+ Tcm (central memory) subsets, and the upregulation of CD8+ CD161+ Tcm during therapy was a dynamic predictor for immunotherapy benefits. Besides, most of CD4+Trm transitioned into CD4+Th1-like cells as an activated status, which considered CD4+Trm as a group of reservoirs with polyclonality and differentiation potential for tumor-killing. Meanwhile, the increase in CD5+ cDC2 (type 2 conventional dendritic cell) after chemotherapy was associated with enhanced antigen-presenting function and cell communication and co-stimulation with CD4+ Trm cells which helped the activated transition from CD4+Trm into CD4+Th1-like cells in lymph nodes. Moreover, CD4+Th1-like cells increased secretion of Th1 cytokines thus leading to promote CD8+CD161+ Tcm upregulation and tumor-infiltration after immunotherapy. Conclusions: A novel peripheral pattern based on subsets of T cells as C-type and E-type was established as potential predictors for immunotherapy stratification in eTNBC patients. Meanwhile, a novel peripheral CD4+Trm immune network was identified, in which CD5+cDC2 activated the transition of CD4+Trm into CD4+Th1-like subset leading to activation and tumor-infiltration of CD8+CD161+Tcm. All the above provided potential therapeutic targets for enhancing immunotherapy. Citation Format: Zehao Wang, Zhibo Shao, Bingqiu Xiu, Jiong Wu. A novel peripheral CD4+ T cell immune network associated with response to PD-1 inhibitor in early-stage triple negative breast cancer [abstract]. In: Proceedings of the 2023 San Antonio Breast Cancer Symposium; 2023 Dec 5-9; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2024;84(9 Suppl):Abstract nr PO2-03-11.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Itaconate as a potential target for antimalarial therapy

In a recent publication, Ramalho et al. investigated monocyte-derived dendritic cell (MODC) mobilization in response to Plasmodium infection. The authors showed that elevated levels of itaconate in MODCs results in reduced CD8 T cell activation and that the absence of itaconate is associated with enhanced parasite control.

Human influenza virus infection elicits distinct patterns of monocyte and dendritic cell mobilization in blood and the nasopharynx.

During respiratory viral infections, the precise roles of monocytes and dendritic cells (DCs) in the nasopharynx in limiting infection and influencing disease severity are incompletely described. We studied circulating and nasopharyngeal monocytes and DCs in healthy controls (HCs) and in patients with mild to moderate infections (primarily influenza A virus [IAV]). As compared to HCs, patients with acute IAV infection displayed reduced DC but increased intermediate monocytes frequencies in blood, and an accumulation of most monocyte and DC subsets in the nasopharynx. IAV patients had more mature monocytes and DCs in the nasopharynx, and higher levels of TNFα, IL-6, and IFNα in plasma and the nasopharynx than HCs. In blood, monocytes were the most frequent cellular source of TNFα during IAV infection and remained responsive to additional stimulation with TLR7/8L. Immune responses in older patients skewed towards increased monocyte frequencies rather than DCs, suggesting a contributory role for monocytes in disease severity. In patients with other respiratory virus infections, we observed changes in monocyte and DC frequencies in the nasopharynx distinct from IAV patients, while differences in blood were more similar across infection groups. Using SomaScan, a high-throughput aptamer-based assay to study proteomic changes between patients and HCs, we found differential expression of innate immunity-related proteins in plasma and nasopharyngeal secretions of IAV and SARS-CoV-2 patients. Together, our findings demonstrate tissue-specific and pathogen-specific patterns of monocyte and DC function during human respiratory viral infections and highlight the importance of comparative investigations in blood and the nasopharynx.

CDX-301 prevents radiation-induced dysregulation of miRNA expression and biogenesis

Risks of radiation exposure necessitate the development ofradioprophylactic drugs. We have reported the efficacy of CDX-301, a recombinantly developed human protein form of Fms-related tyrosine kinase 3 ligand (Flt3L), as a radioprophylactic and radiomitigatory agent. Here, we performed global microRNA profiling to further understand the mechanism of action of CDX-301. We find that CDX-301 administration 24h prior to total body irradiation prevents radiation-induced dysregulation of microRNA biogenesis and expression in murine serum and spleen samples in a time- and tissue-dependent manner. Further analysis shows that activation of the HOTAIR regulatory pathway has a prominent function in radiation-induced injury responses, which is inhibited by pre-treatment with CDX-301. Moreover, CDX-301 attenuates radiation-induced dysregulation of several cellular functions such as inflammatory and immune responses. In corroboration, we also find that pre-treatment with CDX-301 restores the expression of bone marrow aplasia markers and inflammatory cytokines and growth factors, as well as the expression of genes associated with MAP kinase and TGF-β pathways that are altered by radiation. Our findings provide new insights into CDX-301-mediated molecular and cellular mechanisms and point to a possible novel radioprotective drug for the prevention of irradiation-induced injury and hematopoietic acute radiation syndrome.

Contribution of Dendritic Cell Subsets to T Cell-Dependent Responses in Mice.

BATF3-deficient mice that lack CD8+ dendritic cells (DCs) showed an exacerbation of chronic graft-versus-host disease (cGVHD), including T follicular helper (Tfh) cell and autoantibody responses, whereas mice carrying the Sle2c2 lupus-suppressive locus with a mutation in the G-CSFR showed an expansion of CD8+ DCs and a poor mobilization of plasmacytoid DCs (pDCs) and responded poorly to cGVHD induction. Here, we investigated the contribution of CD8+ DCs and pDCs to the humoral response to protein immunization, where CD8neg DCs are thought to represent the major inducers. Both BATF3-/- and Sle2c2 mice had reduced humoral and germinal center (GC) responses compared with C57BL/6 (B6) controls. We showed that B6-derived CD4+ DCs are the major early producers of IL-6, followed by CD4-CD8- DCs. Surprisingly, IL-6 production and CD80 expression also increased in CD8+ DCs after immunization, and B6-derived CD8+ DCs rescued Ag-specific adaptive responses in BATF3-/- mice. In addition, inflammatory pDCs (ipDCs) produced more IL-6 than all conventional DCs combined. Interestingly, G-CSFR is highly expressed on pDCs. G-CSF expanded pDC and CD8+ DC numbers and IL-6 production by ipDCs and CD4+ DCs, and it improved the quality of Ab response, increasing the localization of Ag-specific T cells to the GC. Finally, G-CSF activated STAT3 in early G-CSFR+ common lymphoid progenitors of cDCs/pDCs but not in mature cells. In conclusion, we showed a multilayered role of DC subsets in priming Tfh cells in protein immunization, and we unveiled the importance of G-CSFR signaling in the development and function pDCs.

Abstract 524: The novel STING agonist VB-85247 induces robust durable antitumor immune responses by intravesical administration in a non-muscle invasive bladder cancer model

Abstract Introduction: Bacillus Calmette-Guerin (BCG) unresponsive non-muscle invasive bladder cancer (NMIBC) patients are in great need of effective immunotherapies. STING (Stimulator of Interferon Genes) plays a central role in mounting innate and adaptive immune responses to tumor cells. Activation of the STING pathway leads to the induction of inflammatory cytokines (IFN-α/β, TNF-α, IL-6 and CXCL10), maturation and activation of dendritic cells (DC), and induction of anti-tumor T cells. Our group has developed a novel STING agonist, VB-85247. Here we use a murine NMIBC model to report the potent antitumor effect of VB-85247 compared to standard of care BCG and anti-PD1 checkpoint inhibitor therapy currently used in the management of NMIBC. Methods: We developed a mouse model of Non-Muscle Invasive Bladder Cancer (NMIBC) utilizing orthotopically implanted MB49-Luc cells, permitting BLI (Bioluminescence) measurement of tumor growth by In Vivo Imaging Systems (IVIS). Results: VB-85247 was found to bind to mouse STING and all major variants of human STING protein. VB-85247 induced high levels of IFN-β and other cytokines across cells from different species, including primary human bladder epithelial cells. VB-85247 treatment by intravesical instillation in the mouse model of NMIBC resulted in dose dependent tumor regression starting after the first treatment, achieving up to a 100% complete response rate at the 40 µg dose level after 5 weekly treatments. The treatment was well tolerated, eliciting strong and durable anti-tumor immune responses without any mortality. All cured mice rejected a re-challenge with MB49-Luc cells with no further treatment, demonstrating long-lasting anti-tumor immunity. By contrast, BCG treatment in the same model was not efficacious. Combination with anti-PD1 treatment reduced the dose of VB-85247 needed to achieve 100% complete responses to 20 µg, whereas anti-PD1 treatment alone resulted in only 25% complete responses. In addition, a single dose of 40 µg VB-85247 by bladder instillation in the NMIBC model induced systemic immune responses including serum cytokines demonstrating Type I IFN responses plus DC mobilization and activation in the blood, draining lymph nodes, and spleen within 24 hours. Conclusions: The STING agonist VB-85247 was well tolerated and displayed robust efficacy by bladder instillation in a mouse orthotopic tumor model of NMIBC, achieving up to 100% complete responses. All cured mice rejected fresh inoculations of tumor cells with no further treatment, demonstrating induction of immunologic memory. Treatment with BCG was not efficacious in the model. These results suggest the potential utility of the VB-85247 STING agonist in the treatment of BCG unresponsive NMIBC patients. Based on these data, VB-85247 is being advanced to clinical development. Citation Format: Miglena Prabagar, Venu Bommireddy, Rachael Siegel, Haihua Zheng, Lee Pellegrino, Stanley Nawoschik, Albert Uveges, Steven Paget, Ku Lu, Krista Saufler, Axel Metzger, David Diller, Jason Trama, Grant Gallagher, Chia-Yu Huang, Brian McGuinness, James R. Beasley, Michael McQueney, Martin Adelson, Gary L. Schieven, Eli Mordechai, Rukiye-Nazan Eraslan. The novel STING agonist VB-85247 induces robust durable antitumor immune responses by intravesical administration in a non-muscle invasive bladder cancer model [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 524.

Vaccinia Virus Infection Inhibits Skin Dendritic Cell Migration to the Draining Lymph Node.

There is a paucity of information on dendritic cell (DC) responses to vaccinia virus (VACV), including the traffic of DCs to the draining lymph node (dLN). In this study, using a mouse model of infection, we studied skin DC migration in response to VACV and compared it with the tuberculosis vaccine Mycobacterium bovis bacille Calmette-Guérin (BCG), another live attenuated vaccine administered via the skin. In stark contrast to BCG, skin DCs did not relocate to the dLN in response to VACV. Infection with UV-inactivated VACV or modified VACV Ankara promoted DC movement to the dLN, indicating that interference with skin DC migration requires replication-competent VACV. This suppressive effect of VACV was capable of mitigating responses to a secondary challenge with BCG in the skin, ablating DC migration, reducing BCG transport, and delaying CD4+ T cell priming in the dLN. Expression of inflammatory mediators associated with BCG-triggered DC migration were absent from virus-injected skin, suggesting that other pathways invoke DC movement in response to replication-deficient VACV. Despite adamant suppression of DC migration, VACV was still detected early in the dLN and primed Ag-specific CD4+ T cells. In summary, VACV blocks skin DC mobilization from the site of infection while retaining the ability to access the dLN to prime CD4+ T cells.

Beta-adrenergic blockade blunts inflammatory and antiviral/antibody gene expression responses to acute psychosocial stress.

Dysregulation of the immune system is one potential mechanism by which acute stress may contribute to downstream disease etiology and psychopathology. Here, we tested the role of β-adrenergic signaling as a mediator of acute stress-induced changes in immune cell gene expression. In a randomized, double-blind, and placebo-controlled trial, 90 healthy young adults (44% female) received a single 40 mg dose of the β-blocker propranolol (n = 43) or a placebo (n = 47) and then completed the Trier Social Stress Test (TSST). Pre- and post-stress blood samples were assayed for prespecified sets of pro-inflammatory and antiviral/antibody gene transcripts. Analyses revealed increased expression of both inflammatory and antiviral/antibody-related genes in response to the TSST, and these effects were blocked by pre-treatment with propranolol. Bioinformatics identified natural killer cells and dendritic cells as the primary cellular context for transcriptional upregulation, and monocytes as the primary cellular carrier of genes downregulated by the TSST. These effects were in part explained by acute changes in circulating cell types. Results suggest that acute psychosocial stress can induce an "acute defense" molecular phenotype via β-adrenergic signaling that involves mobilization of natural killer cells and dendritic cells at the expense of monocytes. This may represent an adaptive response to the risk of acute injury. These findings offer some of the first evidence in humans that β-blockade attenuates psychosocial stress-induced increases in inflammatory gene expression, offering new insights into the molecular and immunologic pathways by which stress may confer risks to health and well-being.

Research Highlights

An Extracorporeal Bioartificial Liver Embedded With 3D-layered Human Progenitor-like Cells Relieves Acute Liver Failure in Pigs Li et al. Sci Transl Med. 2020. Regenerative medicine aims to address the worldwide shortage of donor organs. An excellent example of this is the concept of bioartificial livers (BAL) designed to support those in liver failure by removing waste products and providing synthetic function.1 In the study from Li et al, the authors report on the in vivo safety and efficacy of a novel BAL designed using hepatocyte-derived liver progenitor-like cells (HepLPCs) and an air-liquid interface (Ali) bioreactor.2 HepLPCs were immortalized by the addition of HPV E6/7 genes to increase the number of proliferation cycles (and therefore produce adequate numbers to populate the bioreactor). To increase the expression of mature hepatocytes, transcription factors known to have a role in hepatic fate determination were screened. The overexpression of FOXA3 significantly increased hepatic function. To support the large-scale production of iHepLPCs-FOXA3 cells, the authors designed an Ali-BAL capable of supporting 3D expansion, using polyethylene terephthalate-based microporous carriers. Cells grown on these carriers had improved synthetic functions and elevated urea production, ammonia elimination, and glutamine secretion in comparison to those grown on monolayer culture. The clinical benefit of the Ali-BAL was tested in a porcine model of acute liver failure (ALF) induced by D-gal injection. Those in the treatment group were attached to the extracorporeal circulation bioreactor system for 3 hours and demonstrated a significant survival benefit (83% versus 16.7%) at the endpoint of 7 days. They had reduced ammonia concentrations at 48 hours posttreatment, improvements in liver enzymes (ALT/AST/bilirubin), and clotting factors (PT/INR/APTT) in comparison with control and no-cell groups. Furthermore, histological examination demonstrated increased numbers of hepatic parenchymal cells and Ki-67+ hepatocytes (indicating proliferation) in the treatment group, suggesting Ali-BAL may even promote regeneration. The authors explored the mechanism of Ali-BAL on ALF by measuring toxins in the plasma before and after perfusion with the bioreactor. They found urea accumulated in the bioreactor, suggesting it was removed via ureagenesis. In support, there was a reduction in lactate concentrations after perfusion. Although representing a simplified animal model of ALF, the study demonstrates the feasibility, safety, and functionality of the Ali-BAL. Further clinical studies in humans will be required to assess the efficacy of this device, potentially adding to supportive strategies for those patients awaiting liver transplantation. The Lymph Node Stromal Laminin α5 Shapes Alloimmunity Li et al. J Clin Invest. 2020. Lymph nodes are complex and dynamic structures, compartmentalized to facilitate adaptive immune responses through antigen presentation and costimulation and lymphocyte activation and regulation. The function and structure of each area are promoted by stromal cells and structural proteins. Laminins are extracellular matrix proteins produced by stromal cells that contribute as both barriers and coordinators of cellular migration, activation, and differentiation. The ratio of 2 specific subtypes laminin α4 and laminin α5 has divergent roles in immune activation and tolerance.1,2 In the current study by Li et al, the authors dissect the contribution of stromal cells and laminins α4/α5 to the organization of lymph nodes and the coordination of antigen-specific T-cell responses.3 The authors were able to accomplish this by developing laminin α5 knockout mice, in which the Lama5 gene was removed from Pdgfrb-expressing stromal cells such as reticular fibroblasts and blood/lymphatic endothelial cells. Laminin α4 expression was unaffected by this reduction of stromal laminin α5, resulting in a higher α4:α5 ratio. Steady-state lymph nodes saw an increase in the proportion of regulatory T cells (Treg) and greater density of high endothelial venules, both of which colocalized in paracortex. In parallel, the knockout promoted mobilization of myeloid and plasmacytoid dendritic cells to the cortical ridge. These cellular changes were associated with spatially distinct chemokine and adhesion molecule expressions, indicating that the observed cellular changes may be related to migration. Laminin α4 and α5 demonstrated opposing effects on mouse and human T-cell motility, attachment, and transendothelial migration. Laminin α5 severely limited T-cell migration, but this could be rescued by laminin α4 or by blocking α5 receptors. No difference in lymphocyte egress was noted between wild-type and knockout mice, so it was concluded that the absence of laminin α5 promoted T-cell recruitment. Challenging mice with immunizing versus tolerogenic protocols resulted in an increase in allospecific T-cell numbers within peripheral lymph nodes in laminin α5 knockout mice in both conditions. This was associated with a modest decrease in activated effector/memory T-cell phenotype and an increase in the Treg:IL-17+ ratio. In a fully mismatched cardiac transplant model, the knockout of laminin α5 alone was not sufficient to modify rejection kinetics. The reduction in stromal laminin α5 in the knockout mice did, however, work synergistically with laminin α5 receptor blockade, tacrolimus, or anti-CD40L to prolong allograft survival. The importance of lymph nodes in the presentation of alloantigens and the initiation of allospecific responses is well known. This dissection and manipulation of lymph node stromal cell function demonstrate their capacity to influence transplantation outcome and importantly, present the potential of laminin-targeting therapies as complements to existing immunosuppressive strategies. Despite higher numbers of antigen-specific cells found in the lymph nodes of laminin α5 knockout mice, their quality and function were modulated by laminins and their activation limited. Further research will hopefully help us to understand how such a microenvironment favors reduced activation and a greater proportion of Treg, in the absence of changes in T-cell subset migration. It would also be interesting to assess how laminin-targeting approaches impact intragraft infiltration and the development of tertiary lymphoid structures observed during rejection.

Reprogramming the tumor microenvironment with next-generation chaperone-based immunolytic agent for cancer immunotherapy

Abstract The tumor microenvironment (TME) represents a major barrier for successful cancer immunotherapy due to tumor-associated immunosuppressive pathways that facilitate immune evasion and therapeutic resistance. We recently created a multifunctional chimeric chaperone (i.e., Flagrp170) by incorporating the flagellin-derived NF-κB-stimulating sequence for superior antigen cross-presentation and co-stimulation. Upon intralesional administration, this immunolytic agent results in profound inhibition of multiple mouse tumors including melanoma, prostate cancer, colorectal cancer, and mammary tumor. Strikingly, reprogramming the TME with Flagrp170 induces elevation of multiple Th1 cytokines such as GM-CSF, IL-12 and IFN-γ. Mechanistic studies reveal that GM-CSF is mainly produced by CD8+ T cells and is indispensable for the antitumor efficacy of in situ Flagrp170 therapy. Neutralizing GM-CSF abrogates the antitumor activity of the Flagrp170, which is associated with reduced mobilization and recruitment of dendritic cells (DCs) as well as IFN-γ-expressing T cells, suggesting that GM-CSF-derived from tumor-infiltrating T cells is essential for expansion and/or function of DCs within the TME. Our findings elucidate an immunological mechanism of action of the Flagrp170 in skewing the TME towards a Th1-polarized immunostimulatory phenotype and provide a novel approach to reprogramming the immune landscape of the TME for improved immunotherapeutic outcomes.

Mast Cell Responses to Viruses and Pathogen Products.

Mast cells are well accepted as important sentinel cells for host defence against selected pathogens. Their location at mucosal surfaces and ability to mobilize multiple aspects of early immune responses makes them critical contributors to effective immunity in several experimental settings. However, the interactions of mast cells with viruses and pathogen products are complex and can have both detrimental and positive impacts. There is substantial evidence for mast cell mobilization and activation of effector cells and mobilization of dendritic cells following viral challenge. These cells are a major and under-appreciated local source of type I and III interferons following viral challenge. However, mast cells have also been implicated in inappropriate inflammatory responses, long term fibrosis, and vascular leakage associated with viral infections. Progress in combating infection and boosting effective immunity requires a better understanding of mast cell responses to viral infection and the pathogen products and receptors we can employ to modify such responses. In this review, we outline some of the key known responses of mast cells to viral infection and their major responses to pathogen products. We have placed an emphasis on data obtained from human mast cells and aim to provide a framework for considering the complex interactions between mast cells and pathogens with a view to exploiting this knowledge therapeutically. Long-lived resident mast cells and their responses to viruses and pathogen products provide excellent opportunities to modify local immune responses that remain to be fully exploited in cancer immunotherapy, vaccination, and treatment of infectious diseases.

TLR9 and IL-1R1 Promote Mobilization of Pulmonary Dendritic Cells during Beryllium Sensitization.

Metal-induced hypersensitivity is driven by dendritic cells (DCs) that migrate from the site of exposure to the lymph nodes, upregulate costimulatory molecules, and initiate metal-specific CD4+ T cell responses. Chronic beryllium disease (CBD), a life-threatening metal-induced hypersensitivity, is driven by beryllium-specific CD4+ Th1 cells that expand in the lung-draining lymph nodes (LDLNs) after beryllium exposure (sensitization phase) and are recruited back to the lung, where they orchestrate granulomatous lung disease (elicitation phase). To understand more about how beryllium exposures impact DC function during sensitization, we examined the early events in the lung and LDLNs after pulmonary exposure to different physiochemical forms of beryllium. Exposure to soluble or crystalline forms of beryllium induced alveolar macrophage death/release of IL-1α and DNA, enhanced migration of CD80hi DCs to the LDLNs, and sensitized HLA-DP2 transgenic mice after single low-dose exposures, whereas exposures to insoluble particulate forms beryllium did not. IL-1α and DNA released by alveolar macrophages upregulated CD80 on immature BMDC via IL-1R1 and TLR9, respectively. Intrapulmonary exposure of mice to IL-1R and TLR9 agonists without beryllium was sufficient to drive accumulation of CD80hi DCs in the LDLNs, whereas blocking both pathways prevented accumulation of CD80hi DCs in the LDLNs of beryllium-exposed mice. Thus, in contrast to particulate forms of beryllium, which are poor sensitizers, soluble or crystalline forms of beryllium promote death of alveolar macrophages and their release of IL-1α and DNA, which act as damage-associated molecular pattern molecules to enhance DC function during beryllium sensitization.

Voluntary Wheel Running Regulates Tumor Immunogenicity and Response to Immune Checkpoint Therapy

Exercise training is associated with reduced tumor growth and enhanced intratumoral immune cell infiltration. As tumor immunogenicity is vital for the clinical response to immunotherapeutic agents, we aimed to investigate the role of exercise in promoting the response to immune checkpoint inhibition. We observed that voluntary wheel running in B16 tumor-bearing mice increased immune checkpoint expression (PD-L1, PD-L2, B7.1 and B7.2), and this induced expression was associated with the tumor stroma, i.e. fibroblasts and dendritic cells. PD-L1 expression depended on IFN-γ stimulation from infiltrating cytotoxic immune cells, whereas B7.1 expression depended exercise-mediated mobilization of dendritic cells, and was augmented by aspirin treatment. Combining voluntary wheel running with anti-PD-L1 treatment markedly (-83%, p<0.05) reduced B16 tumor growth and augmented immune checkpoint expression and intratumoral immune cell infiltration. This study demonstrates that exercise can make tumors more prone to respond to immune therapy, highlighting that exercise may enhance anti-cancer treatment efficacy.

Laser Adjuvant-Assisted Peptide Vaccine Promotes Skin Mobilization of Dendritic Cells and Enhances Protective CD8+ TEM and TRM Cell Responses against Herpesvirus Infection and Disease.

There is an urgent need for chemical-free and biological-free safe adjuvants to enhance the immunogenicity of vaccines against widespread viral pathogens, such as herpes simplex virus 2 (HSV-2), that infect a large proportion of the world human population. In the present study, we investigated the safety, immunogenicity, and protective efficacy of a laser adjuvant-assisted peptide (LAP) vaccine in the B6 mouse model of genital herpes. This LAP vaccine and its laser-free peptide (LFP) vaccine analog contain the immunodominant HSV-2 glycoprotein B CD8+ T cell epitope (HSV-gB498-505) covalently linked with the promiscuous glycoprotein D CD4+ T helper cell epitope (HSV-gD49-89). Prior to intradermal delivery of the LAP vaccine, the lower-flank shaved skin of B6 or CD11c/eYFP transgenic mice received a topical skin treatment with 5% imiquimod cream and then was exposed for 60 s to a laser, using the FDA-approved nonablative diode. Compared to the LFP vaccine, the LAP vaccine (i) triggered mobilization of dendritic cells (DCs) in the skin, which formed small spots along the laser-treated areas, (ii) induced phenotypic and functional maturation of DCs, (iii) stimulated long-lasting HSV-specific effector memory CD8+ T cells (TEM cells) and tissue-resident CD8+ T cells (TRM cells) locally in the vaginal mucocutaneous tissues (VM), and (iv) induced protective immunity against genital herpes infection and disease. As an alternative to currently used conventional adjuvants, the chemical- and biological-free laser adjuvant offers a well-tolerated, simple-to-produce method to enhance mass vaccination for widespread viral infections.IMPORTANCE Herpes simplex viruses 1 and 2 (HSV-1 and HSV-2) infect a large proportion of the world population. There is an urgent need for chemical-free and biological-free safe adjuvants that would advance mass vaccination against the widespread herpes infections. The present study demonstrates that immunization with a laser-assisted herpes peptide vaccine triggered skin mobilization of dendritic cells (DCs) that stimulated strong and long-lasting HSV-specific effector memory CD8+ T cells (TEM cells) and tissue-resident CD8+ T cells (TRM cells) locally in the vaginal mucocutaneous tissues. The induced local CD8+ T cell response was associated with protection against genital herpes infection and disease. These results draw attention to chemical- and biological-free laser adjuvants as alternatives to currently used conventional adjuvants to enhance mass vaccination for widespread viral infections, such as those caused by HSV-1 and HSV-2.

Influence of polyphenol-rich diet on exercise-induced immunomodulation in male endurance athletes.

Stress is associated with increased susceptibility to infection. We investigated if the mechanism involves immunomodulation of dendritic cells and whether this can be inhibited by a polyphenol-rich diet. Blood samples were taken from a total of 100 male endurance athletes at 5 time points around a marathon run: 4 weeks before; 1 week before; and immediately, 24 h, and 72 h after. Participants were randomized into 2 double-blinded groups. One group received a polyphenol-rich beverage during a 3-week training phase before marathon while the other group received a placebo beverage. Flow cytometric analysis of dendritic cell (DC) counts and subpopulation counts (myeloid, plasmocytoid DCs) was performed. Levels of viral antigen presenting toll-like receptor (TLR) 7 messenger RNA was measured by real-time polymerase chain reaction. Marathon running induced a significant increase of circulating myeloid DCs (0.2% vs. 0.33% of whole-blood leukocytes (wbl); p < 0.01) and a significant decrease of plasmozytoid DCs (0.12% vs. 0.03% of wbl; p < 0.01) and TLR7 expression (decline of 60%; p < 0.01). Polyphenol supplementation did not significantly affect mobilization of dendritic cells but showed beneficial effects on regeneration of TLR7 expression in wbl at 3 days postmarathon (decline of 40% vs. increase of 1000%; p < 0.05). In conclusion, physical stress affects circulating DCs, with an increase of myeloid and a decrease of plasmozytoid DCs. This may partially explain the susceptibility to viral infections after strenuous exercise. These detrimental effects are not attenuated by polyphenol supplementation. However, polyphenols support regeneration of viral antigen presenting TLR7 after strenuous exercise.

Identification of a novel tolerogenic cell subset in the treatment of autoimmune diseases

Abstract We previously reported granulocyte macrophage colony-stimulating factor (GM-CSF) prevented type 1 diabetes in NOD mice through CD11c+CD8− dendritic cell (DCs) mobilization, precipitating regulatory T-cell (Treg) expansion. Furthermore, we found GM-CSF derived bone-marrow dendritic cells (G-BMDCs) can drive Treg expansion in ex-vivo CD4+splenic T-cell co-cultures through surface-bound molecule OX40L. To determine whether GM-CSF may lead to the formation of a distinct, novel CD11c+OX40L+ expressing DC subset, we generated OX40L+G-BMDCs (CD11c+OX40L+) and analyzed these cells through flow cytometry for various cell lineage markers. We determined OX40L+G-BMDCs expressed increased levels of co-stimulatory molecules CD80, CD86, PD-L1 and MHC-II in comparison to the OX40L− counterpart. Additionally, OX40L+G-BMDCs lacked expression of Ly6G, Ly6C, FceR1, surface markers indicative of granulocyte and mast cell lineage, but to our surprise, highly expressed macrophage markers F4/80, MerTK, and CD200R. To elucidate an in vivo physiological component of these OX40L+ G-BMDCs, we performed an unsupervised hierarchical clustering comparing the transcriptome of OX40L+G-BMDCs to that of all myeloid and lymphoid lineages from the Immgen database. We found that OX40L+G-BMDCs clustered most closely with macrophages and dendritic cells. Furthermore, a principal component analysis with the transcriptome of OX40L+G-BMDCs and that of macrophages and dendritic cells from the Immgen database revealed OX40L+G-BMDCs most closely clustered with macrophages. Collectively, these results suggest OX40L+ G-BMDCs may represent a distinct GM-CSF dependent, macrophage-like cell subset involved in physiological Treg homeostasis.

A CFSE-based Assay to Study the Migration of Murine Skin Dendritic Cells into Draining Lymph Nodes During Infection with &lt;em&gt;Mycobacterium bovis&lt;/em&gt; Bacille Calmette-Gu&amp;#233;rin

Dendritic cells (DCs) are important for initiating immune responses, in part through their ability to acquire and shuttle antigen to the draining lymph node (DLN). The mobilization of DCs to the DLN is complex and remains to be fully elucidated during infection. Herein described is the use of an innovative, simple assay that relies on the fluorochrome 5- and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE) to track the migration of DCs during footpad infection with Mycobacterium bovis Bacille Calmette-Guérin (BCG) in C57BL/6 mice. This assay enables the characterization of skin DC sub-populations that actively relocate to the draining, popliteal LN in response to BCG. This protocol originates from a BCG model where migratory skin DCs were identified by flow cytometry. The assay is amiable to the study and identification of DCs or other cells that home to the popliteal LN after inoculation of microbes, their metabolites or other inflammatory stimuli in the footpad, and consequently to study factors that regulate the migration of these cells.

A CFSE-based Assay to Study the Migration of Murine Skin Dendritic Cells into Draining Lymph Nodes During Infection with Mycobacterium bovis Bacille Calmette-Guérin.

Dendritic cells (DCs) are important for initiating immune responses, in part through their ability to acquire and shuttle antigen to the draining lymph node (DLN). The mobilization of DCs to the DLN is complex and remains to be fully elucidated during infection. Herein described is the use of an innovative, simple assay that relies on the fluorochrome 5- and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE) to track the migration of DCs during footpad infection with Mycobacterium bovis Bacille Calmette-Guérin (BCG) in C57BL/6 mice. This assay enables the characterization of skin DC sub-populations that actively relocate to the draining, popliteal LN in response to BCG. This protocol originates from a BCG model where migratory skin DCs were identified by flow cytometry. The assay is amiable to the study and identification of DCs or other cells that home to the popliteal LN after inoculation of microbes, their metabolites or other inflammatory stimuli in the footpad, and consequently to study factors that regulate the migration of these cells.

Skin tumor immunity: Site does matter for antigen presentation by DCs.

The immune system has the ability to specifically identify and eliminate tumors, but the underlying mechanisms responsible for this phenomenon are not fully understood. A study published in this issue of the European Journal of Immunology now provides new insights into this important problem. Joncker et al. [Eur. J. Immunol. 2016. 46: 609-618] show that the timely mobilization of tumor antigen-bearing dendritic cells (DCs) from the periphery to the lymph nodes is critical for effective antitumor T-cell immunity, and that DCs present tumor antigens much more efficiently when encountered in the skin rather than in the subcutaneous tissues.